Commit 688ffc1d authored by Russ Cox's avatar Russ Cox

test/bench revisions;

  * reverse-complement: port C algorithm to Go
	saves 30% on my MacBook Pro and makes it a fairer comparison.
  * test reverse-complement with and without GC (another 15%)
  * revise timing.sh to work on more systems
  * avoid two glibcisms in fasta.c

R=r
https://golang.org/cl/156110
parent 9bc6a404
......@@ -82,7 +82,7 @@ static void repeat_fasta (char const *s, size_t count) {
memcpy (s2 + len, s, WIDTH);
do {
size_t line = MIN(WIDTH, count);
fwrite_unlocked (s2 + pos,1,line,stdout);
fwrite (s2 + pos,1,line,stdout);
putchar_unlocked ('\n');
pos += line;
if (pos >= len) pos -= len;
......@@ -113,7 +113,7 @@ static void random_fasta (aminoacid_t const *genelist, size_t count) {
buf[pos++] = genelist[i].c;
} while (pos < line);
buf[line] = '\n';
fwrite_unlocked (buf, 1, line + 1, stdout);
fwrite (buf, 1, line + 1, stdout);
count -= line;
} while (count);
}
......@@ -163,11 +163,11 @@ GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\
AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\
AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
fputs_unlocked (">ONE Homo sapiens alu\n", stdout);
fputs (">ONE Homo sapiens alu\n", stdout);
repeat_fasta (alu, 2 * n);
fputs_unlocked (">TWO IUB ambiguity codes\n", stdout);
fputs (">TWO IUB ambiguity codes\n", stdout);
random_fasta (iub, 3 * n);
fputs_unlocked (">THREE Homo sapiens frequency\n", stdout);
fputs (">THREE Homo sapiens frequency\n", stdout);
random_fasta (homosapiens, 5 * n);
return 0;
}
......@@ -92,29 +92,41 @@ func output(buf []byte) {
func main() {
in = bufio.NewReader(os.Stdin);
buf := make([]byte, 100*1024);
top := 0;
for {
buf := make([]byte, 1024*1024);
line, err := in.ReadSlice('\n');
if err != nil {
break
}
if line[0] == '>' {
if top > 0 {
output(buf[0:top]);
top = 0;
}
for err == nil {
os.Stdout.Write(line);
continue;
// Accumulate reversed complement in buf[w:]
nchar := 0;
w := len(buf);
for {
line, err = in.ReadSlice('\n');
if err != nil || line[0] == '>' {
break;
}
line = line[0 : len(line)-1]; // drop newline
if top+len(line) > len(buf) {
nbuf := make([]byte, 2*len(buf)+1024*(100+len(line)));
copy(nbuf, buf[0:top]);
line = line[0:len(line)-1];
nchar += len(line);
if len(line)+nchar/60+128 >= w {
nbuf := make([]byte, len(buf)*5);
copy(nbuf[len(nbuf)-len(buf):len(nbuf)], buf);
w += len(nbuf) - len(buf);
buf = nbuf;
}
copy(buf[top:len(buf)], line);
top += len(line);
for r := 0; r < len(line); r++ {
w--;
buf[w] = complement[line[r]];
}
}
// Copy down to beginning of buffer, inserting newlines.
// The loop left room for the newlines and 128 bytes of padding.
i := 0;
for j := w; j < len(buf); j += 60 {
n := copy(buf[i:i+60], buf[j:len(buf)]);
buf[i+n] = '\n';
i += n+1;
}
os.Stdout.Write(buf[0:i]);
}
output(buf[0:top]);
}
#!/bin/sh
#!/usr/bin/env bash
# Copyright 2009 The Go Authors. All rights reserved.
# Use of this source code is governed by a BSD-style
# license that can be found in the LICENSE file.
......@@ -59,7 +59,8 @@ run() {
echo -n ' '$1' '
$1
shift
(/home/r/plan9/bin/time $* 2>&1 >/dev/null) | sed 's/r.*/r/'
echo $((time -p $* >/dev/null) 2>&1) | awk '{print $4 "u " $6 "s " $2 "r"}'
}
fasta() {
......@@ -78,6 +79,11 @@ revcomp() {
run 'gccgo -O2 reverse-complement.go' a.out < x
run 'gc reverse-complement' $O.out < x
run 'gc_B reverse-complement' $O.out < x
export GOGC=off
runonly echo 'GOGC=off'
run 'gc reverse-complement' $O.out < x
run 'gc_B reverse-complement' $O.out < x
unset GOGC
rm x
}
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment