clean up the code a bit

start a log of progress

R=rsc
DELTA=222  (185 added, 17 deleted, 20 changed)
OCL=32701
CL=32718

test/bench/fasta.go

@@ -49,7 +49,7 @@ var out *bufio.Writer
 
 var n = flag.Int("n", 1000, "length of result")
 
-const WIDTH = 60
+const WIDTH = 60	// Fold lines after WIDTH bytes
 
 func min(a, b int) int {
 	if a < b {
@@ -65,6 +65,7 @@ type AminoAcid struct {
 
 var	lastrandom uint32 = 42
 
+// Random number between 0.0 and 1.0
 func myrandom() float {
 	const (
 		IM = 139968;
@@ -77,24 +78,22 @@ func myrandom() float {
 }
 
 func AccumulateProbabilities(genelist []AminoAcid) {
-	cp := 0.0;
-	for i := 0; i < len(genelist); i++ {
-		cp += genelist[i].p;
-		genelist[i].p = cp;
+	for i := 1; i < len(genelist); i++ {
+		genelist[i].p += genelist[i-1].p;
 	}
 }
 
-/* This function prints the characters of the string s. When it */
-/* reaches the end of the string, it goes back to the beginning */
-/* It stops when the total number of characters printed is count. */
-/* Between each WIDTH consecutive characters it prints a newline */
-/* This function assumes that WIDTH <= strlen (s) + 1 */
+// RepeatFasta prints the characters of the byte slice s. When it
+// reaches the end of the slice, it goes back to the beginning.
+// It stops after generating count characters.
+// After each WIDTH characters it prints a newline.
+// It assumes that WIDTH <= len(s) + 1.
 func RepeatFasta(s []byte, count int) {
 	pos := 0;
 	s2 := make([]byte, len(s) + WIDTH);
 	bytes.Copy(s2, s);
 	bytes.Copy(s2[len(s):len(s2)], s);
-	for {
+	for count > 0 {
 		line := min(WIDTH, count);
 		out.Write(s2[pos:pos+line]);
 		out.WriteByte('\n');
@@ -103,43 +102,31 @@ func RepeatFasta(s []byte, count int) {
 			pos -= len(s);
 		}
 		count -= line;
-		if count <= 0 {
-			break
-		}
 	}
 }
 
-/* This function takes a pointer to the first element of an array */
-/* Each element of the array is a struct with a character and */
-/* a float number p between 0 and 1. */
-/* The function generates a random float number r and */
-/* finds the first array element such that p >= r. */
-/* This is a weighted random selection. */
-/* The function then prints the character of the array element. */
-/* This is done count times. */
-/* Between each WIDTH consecutive characters, the function prints a newline */
+// Each element of genelist is a struct with a character and
+// a floating point number p between 0 and 1.
+// RandomFasta generates a random float r and
+// finds the first element such that p >= r.
+// This is a weighted random selection.
+// RandomFasta then prints the character of the array element.
+// This sequence is repeated count times.
+// Between each WIDTH consecutive characters, the function prints a newline.
 func RandomFasta(genelist []AminoAcid, count int) {
 	buf := make([]byte, WIDTH + 1);
-	for {
+	for count > 0 {
 		line := min(WIDTH, count);
-		pos := 0;
-		for {
+		for pos := 0; pos < line; pos++ {
 			r := myrandom();
 			var i int;
 			for i = 0; genelist[i].p < r; i++ {
 			}
 			buf[pos] = genelist[i].c;
-			pos++;
-			if pos >= line {
-				break
-			}
 		}
 		buf[line] = '\n';
 		out.Write(buf[0:line + 1]);
 		count -= line;
-		if count <= 0 {
-			break
-		}
 	}
 }
 
@@ -177,7 +164,7 @@ func main() {
 	AccumulateProbabilities(iub);
 	AccumulateProbabilities(homosapiens);
 
-	alu := strings.Bytes(""
+	alu := strings.Bytes(
 		"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
 		"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
 		"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
@@ -188,11 +175,8 @@ func main() {
 
 	out.WriteString(">ONE Homo sapiens alu\n");
 	RepeatFasta(alu, 2 * *n);
-	out.Flush();
 	out.WriteString(">TWO IUB ambiguity codes\n");
 	RandomFasta(iub, 3 * *n);
-	out.Flush();
 	out.WriteString(">THREE Homo sapiens frequency\n");
 	RandomFasta(homosapiens, 5 * *n);
-	out.Flush();
 }

test/bench/timing.log

+All tests on r45
+
+Aug 3 2009
+
+First version of fasta. Translation of fasta.c, fetched from
+	http://shootout.alioth.debian.org/u32q/benchmark.php?test=fasta&lang=gpp&id=4
+
+fasta -n 25000000
+	[gcc -O2 fasta.c	5.98u 0.00s 6.01r]
+	gccgo -O2	8.82u 0.02s 8.85r
+	6g	13.50u 0.02s 13.53r
+	6g -B	12.99u 0.02s 13.02r
+